Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13375H11
Clone ID IST13375H11
Vector VICTR74
Project tigm

Sequence tag IST13375H11HMF1
Sequence
GATAAGTGGCTTTCCGAACTTANATCACGAGAGCCTTCTTGAAGTGCAGCCACATGCAGACATGAAGAGCATCTGCAGAT
TCAAGAAACAGGAAAGGGACAAACATGGAACCTAGGAGCCAGCGCCTCAGCACACCGGAGCTCATTAACACTGGGTCCTA
ACAGTGTGGTGCTCACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100237757..100237938 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es