Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0001
Clone ID BC0001
Vector pGT2lxr
Project sanger

Sequence tag BC0001
Sequence
AAATAACAAAGCCCGTGGAAGGTGCCAAGAAGGAGGGCGCTGCCGGCTTCTTTAAAGGAATTGGAAAAGGGCTTGTGGGT
GCCGTGGCTCGTCCAACTGGCGGGATCATAGATATGGCTAGCAGCACCTTCCAAGGCATTCAGAG
Sequence Type mRNA
Unitrap ID UNI1991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67821545..67823712 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035284 (Vps13c) NM_177184 vacuolar protein sorting 13C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444207]

 
Come back to gene ENSMUSG00000035284


For any suggestions or comments, please send an email to unitrap@crg.es