Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_355C2-3
Clone ID CMHD-GT_355C2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_355C2-3
Sequence
TAAATTTTATGTCCACAATGATATGTTTCGTTATGAAGATGAAGTGTTTGGTGATTCTGAACCAAAACTTGATGAAGAGT
CAAAAGATGAAGTGGAAGAGGAGCAAGAAGACCGGCAGCCGTCTCCTGAACCTGTGCAAGAGAATGCTAACAGCGCTTAC
TATGACGCACACCCCGTGACTAATGGCATAGAGGAGCCTTTAGAAGAATCCTCTCATGAACCTGAGCCTGAGCCAGAATC
TGAAACAAAGACTGAAGAGCTGAAAC
Sequence Type mRNA
Unitrap ID UNI12936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92493446..92495594 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es