Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14184H11
Clone ID IST14184H11
Vector VICTR74
Project tigm

Sequence tag IST14184H11HMR1
Sequence
TTACATTAAATAGGAGAGATGAGCATGCAGATCAAAGACCACATCATTTCAGAGCTCCAAGGAGTGGGCCCATTTTCTCT
GCTTAGTTAGAGTTTTGCTTCATTAGT
Sequence Type genomic DNA
Unitrap ID UNI32677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37926340..37926446 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039087 (Rreb1) NM_001013392 ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]

 
Come back to gene ENSMUSG00000039087


For any suggestions or comments, please send an email to unitrap@crg.es