Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_352E3-3
Clone ID CMHD-GT_352E3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_352E3-3
Sequence
ACCATGAAAAAAGACATTTCCATGGGCACTATGACCCTGAATATAGACATGATCAACAAAGACCCTTTACTTGGAGAATG
GATGATGAAAAACATGGACAAAATAAACCAAGGATTCCCCCTCGTGTGAATTCGTATCATCGGTCTTATGTAAATAGATC
ACCTTCTCCAAATGTAAAACCTGTTGAAAAATTTGATACATATAAGCCTCACCAAGAATATTTTCCTGGCAAAGGAGATG
ATGACAGACGATCTCAGTATATGCCCACATACACAGAAAGTGCAGCAACCTACATGGAGCACGAAAGGGATTGTTATATC
CCTACAGTGCAAGGAAGGTATACTCCTGATGATCACAGAGGTAGAGGTAGAGGAAGTGGGAGAGGAGAGAAGCCACCTCA
GATGTCACTGGGGAAGCCACCTAAGATGTCACTGGGGAAGCCACCTCAAATGTCACTGGCAGATTCCTTGAGATTTAAAG
AGAAATGGCATGAAGATGAATTGAGACACCAGAGGGTACAAGAAGAAAGCTACCCTCAGTCACCCAGAAGAGGCTCAGAA
GACTTTGGCACAAGGAACCCTTTTCAAAAGAGGTATCCCGAGGATCATGATTTCAGAAAGTATGGCTACACATCAAAAAG
ACCTACAGATGCAGCAAGGTATGAAAATAGAGATCCAGCCAGAAT
Sequence Type mRNA
Unitrap ID UNI12940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155989715..155991268 587
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es