Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14170E2
Clone ID IST14170E2
Vector VICTR74
Project tigm

Sequence tag IST14170E2HMF1
Sequence
GGACTCCTAAGACTACGACCCTTTGACCATGCCACTCAGTATCTCAAGAACCCTTAAAGTCCCAAAGGAATCGGACCTTG
CACTTGTCCTCAGGCAATAGAGTCCAACAGATATGCAAGAACGGGATCAGGGGCTCCCTGTTGCTCAGACCTGAGCCCTC
CAGGCAGCAGAAGCTCACCTGATCCCTCCCCACCCTGCTCCCCAAAGGTGAAAAGGAGAGGATTCCCCAATGTAAGGTAG
GACCTCCCCATCTCCACCTACTCCTGCAGGCAGGAATCTCAGGTTTCTCACACCCTCTCCTCAGCACCCAGGTTCCTGTC
TCCAGAGCATGAATTCCAGGTCCAATGCTAGAGGGGAGAACCTAATGCAAGTGTGCCTTGCCACCCCAAGTTTGGGAGAC
TCTGCTCTTATCCTGANGACTACTGAATTCTTTTAACCCCTACCCAGTGAGATGANAACTACATATCCCTCTTTANGGGA
TGGTGTGTGTATGTGTGTGTGATGGANAATCTGGGCATCTGGGTTGGGANTTN
Sequence Type genomic DNA
Unitrap ID UNI33285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20302058..20302589 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es