Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12937C1
Clone ID IST12937C1
Vector VICTR76
Project tigm

Sequence tag IST12937C1HMF1
Sequence
NAAACAGGGGAGGAGTGAGCGGGCTGATTTATGGGAACTGGGGGCTCTGTCTGGTACTCCTCTCGAGGATGCTAGAAGGA
CCCCANAGTTGGTCCCGGGTGTGCCAGAGTGTCCGTGTGAGACACTGAGGGACAGAACGGACGACCGTGTGTGCAGGANA
GACCTGGA
Sequence Type genomic DNA
Unitrap ID UNI33453

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41643050..41643215 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es