Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_351C12-3
Clone ID CMHD-GT_351C12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_351C12-3
Sequence
CTGACCTGAATAATGTCAGGTTCTCCGCGTATAGGACTGCCATGAAGCTCAAAAGGCTCCAGAAGGCCCTTTGCTTGGAT
CTCTTGAGCCTGTCAGCTGCATGTGATGCCCTGGACCAGCACAACCTCAAGC
Sequence Type mRNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82335156..82350539 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es