Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14239D4
Clone ID IST14239D4
Vector VICTR74
Project tigm

Sequence tag IST14239D4HMR1
Sequence
NTCCACTTCCCAGCACCTGGNNGGTAAGAAGCAGGCAGCTAGATGAGGCCNCCTGTGAGGAGCTTTGTGGACCTAGTCTC
CTCTTGGACCCGGCTGTGGCCTCTGAATAACTTTATTATTGGGCTGCATCTGCACAAAACATTTGCAGGAGGGGCTACTC
TAGAGAAATGTACTTGGCAGGATGACAAACTTGACAGCCCTTGTTTCTATATTATCTTCTCTAAGTTCTGCCTTTANCAN
TTC
Sequence Type genomic DNA
Unitrap ID UNI4932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176865091..176865331 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]


Sequence tag IST14239D4BBF1
Sequence
TAACTACAAGTGCATTTCTTGCTAAGCTGCTTGCTCCTCCTCTCTGTGGGAGATGACTTTGCACTTACCATGTCTGGAGT
TCTGAGCTTGCTAGGTCCCCTCACATCACTCAGTAGAGGCCCTCAAAACACATTCCACAGAAACGCAAAGATCAGATGAA
TTACAGGGAGGAAGTTGCTGGCTTGGAACCAGGAAGAGCTGCCTCCTTTTCTGACTGCCAGCTGTGTANAGATTCTGGTT
GGCTCAAGAGTCTTGAGTGACATGTTAACTACCCTTAGGGTTAGGGTGTGCTGAAGGACACAGTTCCAACCTGGGGCAAT
TGTTTTCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176864759..176865091 331
 
EST/CDNA Est Name
  CX211778.1 - BI248726.1


Sequence tag IST14239D4HMF1
Sequence
TAACTACAAGTGCATTTCTTGCTAAGCTGCTTGCTCCTCCTCTCTGTGGGAGATGACTTTGCACTTACCATGTCTGGAGT
TCTGAGCTTGCTAGGTCCCCTCACATCACTCAGTAGAGGCCCTCAAAACACATTCCACAGAAACGCAAAGATCAGATGAA
TTACAGGGAGGAAGTTGCTGGCTTGGAACCAGGAAGAGCTGCCTCCTTTTCTGACTGCCAGCTGTGTANAGATTCTGGTT
GGCTCAAGAGTCTTGAGTGACATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176864827..176865091 263
 
EST/CDNA Est Name
  BI248726.1

 
Come back to gene BI248726.1


For any suggestions or comments, please send an email to unitrap@crg.es