Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_355H9-3
Clone ID CMHD-GT_355H9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_355H9-3
Sequence
GCAGGACAGACGGCCCTGATGCTGGCCGTCAGCCACGGGCGGGTGGACGTGGTGAGAGCATTGCTGGCCTGTGAGGCGGA
CGTCAACATTCAGGATGAGGACGGCTCCACGGCCCTGATGTGTGCATGTGAGCACGGACACAAGGAGATCACCGGGCTCC
TGCTGGGTGTGCCTAGCTGTGACATCTCACTCACTGACCGCGACGGGAGCACAGCACTGATGGTGGCCCTGGACGCTGGG
CAAAACGAGATCCCATCTATGCTGTACTCACGCATGAACATCAAGTGCTCGTTCGCTCCCATGTCAAACTACTAGAGTCC
GGCTTCGTCTTCAGCCGAGGAGTGAATACAGGGAGGAGCCAGTGAGTCCCCCAGGACCCACCAGCCACAAGCCACGCATC
AAACCGTCCCTCCTCCATCCCTCTGTCCCATTCTGCCTCGGCATTCCTCAGCCCCTGAACTTCCCTGAGGGAGCCCTGAC
ATCTACCAGGCTCAAGCTCCTGGAAGCCTTTCCCAGCACCCTGGGTTCAAAGCC
Sequence Type mRNA
Unitrap ID UNI12951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21573206..21574570 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es