Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_350D12-3
Clone ID CMHD-GT_350D12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_350D12-3
Sequence
GAGTCTCCGGTGCCCCTTATGCCCGCCTGTGCCTTGCTCAGCATGGGTGGGGGGCTGATTGAGAGGTATGTGGCTGCCAT
GGTGCTGAGCGCGGCTGGAGATACCTTGGGCTACTTCAACGGGAAGTGGGAGTTCATTCGGGATGGGGAGACGATACACC
AGCAGTTGGCCCAGATGGGTGACTTGGAAGCCATAGATGTGGCACGATGGAGAGTCAGTGATGATACCGTCATGCACCTG
GCCACAGCGGAGGCCCTCATGGAAGCCGGCCAGTCCCCGGATTTGCCTCGGCTGTATTCCCTACTAGCCAAACATTACCG
GGACTGCATGGGAGACATGGATGGCCGGGCACCAGGTGGTGCTTGCATGCAGAACGCCATGCTGCTACAGCCCAACAGGG
CCGACGGCTATAGGATTCCCTTCAACAGTCACGAGGGTGGCTGCGGGGCTGCCATGCGCGCCATGGTGCATCGGGCTGAG
GTTCCCCCACCCCAGCCAACTGGATCTGCTGATCCAAGTGAGCATCGAGAGCGGCCGGATGACCCACCACCACCCCACGG
GCTACCTCGGCAGCCTTGCGTCCGCTCTTTTTACGGCATATGCCGTGAATGGCAAGTCACCATGGCAGTGGGGAAAAGGG
CTAATGGAGGTGCTGCCTGAAGCCAAAAAGTACATCACTCAGTCAGGCTACTTTGTGAAGGAGAATCTTCAACACTGGTC
CTACTTC
Sequence Type mRNA
Unitrap ID UNI12953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38447326..38450563 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002844 (Adprh) NM_007414 ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]

 
Come back to gene ENSMUSG00000002844


For any suggestions or comments, please send an email to unitrap@crg.es