Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10099E12
Clone ID IST10099E12
Vector VICTR76
Project tigm

Sequence tag IST10099E12HMF1
Sequence
CCCAATCCCTGACTTTGGTTTGAAATATGCCTCCCTAGAATGGGAGGCTGATGGATGGGATGTCCCCCTCCTTTTAGCCA
AATTTTATCTTTCTTTTTTTAAAANCCTCCTACTACCTCAGCTTCCTAAGTGCTGGGATTATAGTCATATGTCACTATGA
CTTACAAAGTGGTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97664494..97664677 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es