Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_351E12-3
Clone ID CMHD-GT_351E12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_351E12-3
Sequence
TGGTGCTGATCGGCGAGTCAGGCGTGGGCAAGACCAATCTGCTGTCCCGGTTCACCCGCAATGAGTTCAGCCACGACAGT
CGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTAATGCTGGGCACCGCTGCTGTCAAGGCACAGATCTGGGACAC
GGCCGGCCTGGAGAGATACAGAGCCATCACCTCTGCGTACTATCGTGGGGCCGTGGGGGCACTCCTGGTATTTGACCTGA
CCAAGCACCAGACCTACGCTGTGGTGGAGCGCTGGCTAAAGGAGCTGTATGACCATGCCGAAGCCACGATTGTTGTCATG
CTCGTGGGGAACAAAAGTGACCTCAGCCAGGCCCGAGAGGTCCCTACTGAGGAGGCCTGCATGTTTGCTGAAAACAATGG
CCTGCTGTTCCTGGAGACGTCAGCCCTCGACTCCACCAATGTTGAGCTAGCCTTCCAGACTGTCCTCAAAGAGATCTTTG
CAAAGGTGTCCAAGCAAAACCAGAACAGCACCCGGACCAGTGCCATCACCCTGGGCAATGCCCAAGCTGGACAGGATCCT
GGCCCTGGGGAAAAGAGGGCCTGTTGCATCCACCTCTGACTTCAGCTATGGCCAGCCCCTGTGTCCTGCCTTCAGCTTTC
AAATATCTCCACCTCCCTTACTGCAGGACTTCTCCCTACCCCTGGAATCCCTGAATCACTAGCACGCAGGGGTCATTATG
CCCCTAC
Sequence Type mRNA
Unitrap ID UNI12960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88346045..88349178 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]

 
Come back to gene ENSMUSG00000008601


For any suggestions or comments, please send an email to unitrap@crg.es