Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11618F1
Clone ID IST11618F1
Vector VICTR76
Project tigm

Sequence tag IST11618F1HMR1
Sequence
GAGGCCNGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACCA
Sequence Type genomic DNA
Unitrap ID UNI20948 UNI22269 UNI22335 UNI31185 UNI33458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5207709..5207782 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024855 (Pacs1) NM_153129 phosphofurin acidic cluster sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277113]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27388078..27388151 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4625805..4625878 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11172710..11172783 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037965 (Zc3h7a) NP_666043 zinc finger CCCH type containing 7 A Gene [Source:MGI (curated);Acc:Zc3h7a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 36441430..36441503 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12729500..12729573 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 15888326..15888399 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6355427..6355500 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7861819..7861892 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032000 (Birc3) NM_007464 baculoviral IAP repeat-containing 3 Gene [Source:MGI (curated);Acc:Birc3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8619129..8619202 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18232409..18232482 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10969704..10969777 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 21716593..21716666 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3292602..3292675 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068566 (Myadm) NP_001087233 myeloid-associated differentiation marker Gene [Source:MGI Symbol;Acc:MGI:1355332]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18122378..18122451 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 6128782..6128855 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8566400..8566473 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7337537..7337610 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3198500..3198573 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10191790..10191863 72
NO GENE  

 
Come back to gene ENSMUSG00000068566


For any suggestions or comments, please send an email to unitrap@crg.es