Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_355E5-3
Clone ID CMHD-GT_355E5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_355E5-3
Sequence
GTTACCAGTGAGAAGTTGTGTAGAGCCCAACACGAACTTCACTTCCAAGCTGCCACCTATCTCTGCCTTTTGAGTAGCAT
CCGGCAACATGTAGCCCTTCATCAGGAATTTCATGGCAAGGGTGAGCGTTCAGTGGAGGAGTCTGCTGGTTTAGTGGGCC
TCCAGTTGCCCCGTCAGCCTGGAGGGAAGGGCTGGGAGCCGTGATGCAAAGAGTCCTCAGATGTTCCTTCATTCAAGAGT
TTAACCATTTCTAACAATATGTAGTTATCATTAAATCTTTTTTAAAGTG
Sequence Type mRNA
Unitrap ID UNI12934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38489159..38489447 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019689 (1110001J03Rik) NM_025363 formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913367]

 
Come back to gene ENSMUSG00000019689


For any suggestions or comments, please send an email to unitrap@crg.es