Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_355C4-3
Clone ID CMHD-GT_355C4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_355C4-3
Sequence
GAGCCCCATTCCAAGAGACTTAAAGTTAAATTGACAATTCAGAAAGAGGTGATGAATGGTGCTATCCTGCAGCAAGTGTT
TGTGGTGGATTATGTTGTTCAGTCCCAAATGTGTGGAGACTGCCATAGAGTGGAAGCTAAGGATTTCTGGAAGGCTGTGA
TCCAAGTCAGGCAAAAGACTCTACACAAGAAAACATTCTACTATCTGGAACAGTTGATTTTAAAATATGGAATGCATCAG
AATACACTGCGTATCAAGGAGATTCATGATGGTCTGGATTTTTATTATTCTTCAAAACAGCATGCTCAGAAGATGGTGGA
GTTTCTTCAGGGTATAGTTCCCTGTAGATACAAAGCATCACAAAGATTGATCTCTCAGGATATTCATAGTAACACATACA
ATTACAAGAGTACTTTTTCTGTGGAAATTGTTCCAATATGCAAGGATAATGTTGTCTGTCTATCACCAAAACTGGCACAG
AGCCTTGGAAATATGAGTCAGATATGTATTTGTATACGAGTAACTAGTGCCATCCACCTCATAGACCCAAATACCCTACA
AGTTGCAAATATTGATGGAAACACTTTCTGGAGTCATCCTTTCAATAGTTTATGCCATCCTAAACAGCTCGAAGAGTTTA
TTGTGATAGAATGCAGCACAGTCCGAGATCTGAAGCGAAGTGCGGGGGCT
Sequence Type mRNA
Unitrap ID UNI12972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 69533293..69545558 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027787 (Nmd3) NM_133787 NMD3 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Nmd3-001]

 
Come back to gene ENSMUSG00000027787


For any suggestions or comments, please send an email to unitrap@crg.es