Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_354C11-3
Clone ID CMHD-GT_354C11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_354C11-3
Sequence
ATGCCAGACCAGTTTGATCAGGTGGTCGTGCTCTACCAGCTGCGCTACTCGGGGATGCTGGAGACGGTGAGGATTCGGAA
AGCAGGGTATGCCGTCAGAAGACCCTTTCAGGACTTTTACAAAAGGTATAAAGTGCTGATGAGGAACTTGGCCCTGCCTG
ACGACATCCGAGGGAAGTGCACTGTGCTCCTGCAGGTCTATGACGCTTCTAACAGCGAGTGGCAGCTGGGGAAGACCAAG
GTCTTCCTTCGAGAATCCTTGGAGCAGAAACTGGAAAAGAGGCGGGAAGAGGAGATTGACCGTGCGGCCATGGTGATCCG
AGCTCACATCTTAGGCTACTTGGCACGAAAGCAATATAGAAAGGTCCTCTGTGGTGTGGTGACCATACAAAAGAATTACA
GAGCTTTCCTTGCGAGGAAAAAATTTTTGCACCTGAAAAAGGCAGCCATCGTGTTCCAAAAGCAACTGCGAGGACAGCTG
GCACGCAGGGTTTACAGGCAGCTGTTGGCTGAGAAACGGGAGCTGGAGGAAAAGAAAAGGCGGGAGG
Sequence Type mRNA
Unitrap ID UNI12974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25705776..25709537 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es