Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_353D3-3
Clone ID CMHD-GT_353D3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_353D3-3
Sequence
TTGCAGGTCACCACTGGGAATATGAAGGTGAGATTGGAACTGCACATGGATTGGCACTCCTTTCACCCCAGGACCTCCGC
ACCTGGCATGAAGACTTGTCCTGGGGGAGGGAAAGAGCTTTTCCTGAGCTTCACCCACTAGCTCCTCTTTTTCTCCCTAC
ACACACAGACCCTGGGGCTTACACAAGTGGCTGCTAGACCCTGCTGTAATCATTAAATCCCACATCTCCTGATTCACC
Sequence Type mRNA
Unitrap ID UNI12976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95705825..95706060 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038526 (Car14) NM_011797 carbonic anhydrase 14 Gene [Source:MGI (curated);Acc:Car14-001]

 
Come back to gene ENSMUSG00000038526


For any suggestions or comments, please send an email to unitrap@crg.es