Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_354D10-3
Clone ID CMHD-GT_354D10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_354D10-3
Sequence
GTATATTCAAGAGCAAATGACCAAGAGCCATGTTGGATGGTGGCTGGCTAAAGTTCGGATGATGAAAGGCGAGTTTTATG
TCATTGAATATGCTGCTTGTGATGCCACTTACAATGAAATAGTCACATTTGAACGACTTCGGCCTGTCAATC
Sequence Type mRNA
Unitrap ID UNI12991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33944954..33945437 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027680 (Fxr1) NP_001106659 fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]

 
Come back to gene ENSMUSG00000027680


For any suggestions or comments, please send an email to unitrap@crg.es