Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10131H9
Clone ID IST10131H9
Vector VICTR76
Project tigm

Sequence tag IST10131H9BBR1
Sequence
CCTTGCTTGCCCACACTTGTGAAGACATCCGGGACCTGTCTTAATTGGGAGTTGCTGATGCCTTGCATCTGTTATGTGAT
GGCCGGATCTCAACCCGAGGTCTAAA
Sequence Type genomic DNA
Unitrap ID UNI21930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102018769..102018873 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023044 (Csad) NM_144942 cysteine sulfinic acid decarboxylase Gene [Source:MGI Symbol;Acc:MGI:2180098]


Sequence tag IST10131H9HMF1
Sequence
NACACGTCTTNNNGTTCATGTTTATACANTGTACTCTTGTGAANGCCGAGGAGGANGANGAGGGAGATGCTTCCCATGGC
CCACTGAGAGACCACTTTANTCAGTTCAGGAACAGCCCCCCACTGCTANAACTCACAGGGTTACCTTGGGAACTATGGAG
AGCANAGTGGCTGCTTTGCAAACAGCTGTCTGATGGAGTGGGGN
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148285777..148286038 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es