Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14758F11
Clone ID IST14758F11
Vector VICTR76
Project tigm

Sequence tag IST14758F11BBF1
Sequence
NGNNNNNNNNTGTNNNNNCCNNTANTTAAACAACAACAACAACAACAAAATANAACTGTAGCGTCCAGTGATCTGCTGCT
TTAACTCNGGAAAGCAACAGAGGAANAAGCTGTACCCCCAGTGCCCTTCACCCGTTGCCCCAGAAAACCACAGACATCAA
TAAATAGGCTTGCAGGTTGGTCAGAGAACTCTGTGTTCAGAAGGGTGCTTGAGGACTGACTCTAATTCCTTCACCTCCCC
TGCACCTTCTGGAATTCCGACTCCACTGCGACCTCAGCAAAACCGCAAAAACGACGTGTTGCTGAACCGACACCCGCGCC
ACCGCAGCCGCCGGCATTGCACGCCGGGAGTAGTTTTCCTTTGCGTCCCAAGAATAGCGTACACGANGGCCCCAACTATA
AGTCCCAGANTGCACTGAGCTCGACAGCCTCTGGCGGGCNAGGANTCCCTANAACGGCTTCCTGCCANAATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3301753..3302206 434
 
EST/CDNA Est Name
  BE863071.1


Sequence tag IST14758F11HMF1
Sequence
GTGTCAGGTTTCCCTGGCACTGGAGTTACAGCACTTTGTGAGCTACCATATACGCTCTGGGATCAAACACAGGACCCCTG
CAAGAGCAAGTGTCCTCAACCTGCTGAGTCACCTCCCGACCCCTAAAATGATAATTAAAAAAAAATACATTTATCTATTT
ATTTTGGTNTTCTGAGACAGGTTCTGCTCTCTCTGGAGCCCAGGCTAGCCTTGAATTGCCTCAGCCTCCTGANTTGCTAG
GACCGCACCTGCCTGTTTGAGCGCATTGTCCAGGTTGAAAGTGCTATTGAGGGAGGTGAAGANATTTTCCCAAGGTTACC
CAGCCACCGAATGGTGAGGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79459433..79459775 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es