Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12237D4
Clone ID IST12237D4
Vector VICTR76
Project tigm

Sequence tag IST12237D4BBF1
Sequence
GGTTTAGAAGGCTGTCAGGTAGAAGAAGCCTAGACAGGCTAGGAATAAAATTAGAGACTACTCAAGAGAATGGTTGCAGA
GCCTGGGTCTGCTGAGGGCGAAACCTAGTGCTTTGGGGCCTGGTTTTATCGACAACAATCTTGTGGAGTTGACTCTAATA
TGTGCCTATGTATATTCTTGAGTGGGGGTGTCCCCAATAAGCTTCAAAAGCTTTGCGTGGCCCTGTCAGTGGGTGGAGGG
AGGTGTTTGATGTGGGTGCTGGGCAGCAAACTCTGGTAGGCAGGAAAAGGCCTACACCTTAGCCTCTAAGCATCTCCAGC
CTCCCGGGGCTGGGCTTTAAGTGGGGCGGATCTCATCACGTGGAGCTTTAATATGGANTGAGTTTGGCTTGGTCGCCTAG
ATCAGTAATCTTTGCTCTCANGAGGCANAGTCNAGANANTCNATAATN
Sequence Type genomic DNA
Unitrap ID UNI33469

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53054269..53054715 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062044 (Lmtk3) NM_001005511 lemur tyrosine kinase 3 Gene [Source:MGI (curated);Acc:Lmtk3-001]

 
Come back to gene ENSMUSG00000062044


For any suggestions or comments, please send an email to unitrap@crg.es