Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11698A1
Clone ID IST11698A1
Vector VICTR76
Project tigm

Sequence tag IST11698A1HMR1
Sequence
GAATTAATATGTTTTTGAAGCGTTTTGTGGAGAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCTGTTTTAGGATCAAT
CTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTGA
AAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTANGCACGGAGATACAATTTCTCTCTTTTTTGT
CNTTNAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATNNCN
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749422..124749715 288
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940237..136940530 288
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919691..52919984 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469511..7469804 288
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es