Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12233H8
Clone ID IST12233H8
Vector VICTR76
Project tigm

Sequence tag IST12233H8HMF2
Sequence
AANCANCNNGANANNNGCNNNTGGANNTNNAAAANCTCACAANAATAACAGAGATGTATCCGTGGCCCCAGGTTGGGGTT
TTGCTTGACATACAACCATGTGTCAGTTTATTTTAAAATTCGTTATTATACAGAGTCAAAAATAGAGAAAAAGGACATAC
TTAAGTACAAAAGCACTTAGAAATGGTGATAGAAAGTTTCATTTTAAAACTAATGGCAGGTGGTTCAAAGTGCAGTTTCA
AACAATAACTGAGGGCTGAAAACATAAGGTTTCATCTTGGGGGAAAAATATAAAGGAACCCAGCTATTGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18166560..18166855 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]


Sequence tag IST12233H8BBF1
Sequence
ACTTCCGGCTCTCATTACTCTTAGAGGCGAAACAGTTCCTATCTGTCCCTGCGCTTCTCACTCGGGTCCCTTTCCAAGCC
GACCCTGGCCAGAGATCAAGAGAACTTTTTCCCGCGGAAATGGAGGCGGTTCCGGAAGAGGGGCGGGCGCGATGGATTCT
GGGGATTGTAGTCAAAAGCGCGCGGAGGTCCGCGCCGCTCAGGCGACAACACTCCAGCTGGGAGCACCGAGAGGAGAAAG
GCAACACTTACCGAGACTCGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34752071..34752335 263

 
Come back to gene Mm.29301


For any suggestions or comments, please send an email to unitrap@crg.es