Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11651A10
Clone ID IST11651A10
Vector VICTR76
Project tigm

Sequence tag IST11651A10HMF1
Sequence
CTCCCAGCCTCAGATGTCCTGTTACAGTAAAAGAAAACACACCCAGACTCAGCTAGGAAAATATAAGCCTTCGAGCATGG
AGATTCGAATGAGAGGTGTCCCTCACGGTCTGGGGCACTTGAACACCTGCTCTGCGGCGGCTGCTGTGCGGCAGGGAGTC
TGTCCCCGGGGCANACTTTGAGATTGGAACCCAATTGCTGGAACAATAACAAAAGAGGTTTTAGCACAAGGAATGCAGCT
TTGCTTTAAAAGCCCACTCTTCTGANAACTAACAAAACAGAACAAAACAGAACCNCTCCCTGAGCCCTCTCCCCATACCA
CAGTCNACGC
Sequence Type genomic DNA
Unitrap ID UNI14618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57009020..57009348 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]


Sequence tag IST11651A10HMR1
Sequence
TNNNAACAACAGATTATCTTACAGCCTTGGGGGCTAGGAAATGAACCTGCCTCTAGCAGGGACCTTGGACTAAATTGAAA
CATGTGGTCTATGCAGACACACATGCAAGCTAAGCACCCACACACATAAAAAAAAATCAATTTTTAAAANTCANTTATGG
ACTATTTCATTGTTGCAGGAGGTTTTGTTTTGGTTTTGGTTTTTCGAGACAGGGTTTCTCTGTATANCCCTGGCTGTCCT
GGAGCTCACTTTGTANACCANCTGGCCTCANAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCNCC
ANNANNCCNNGNNTTGCNNGANGTTTNANNCNTGANNCTGNCNNNGTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es