Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14736E7
Clone ID IST14736E7
Vector VICTR76
Project tigm

Sequence tag IST14736E7HMR1
Sequence
AGGAAGCAAGGGAAGGTGGAAAGAATACAAGAAAGACGGAAGGAAAAGAAGGAAGGGAGGAAGGAAAGACAGGCGAGAGT
CCGAAAGATGCTTCTCCTGATACTGAACTAACTGGGCTTTATTTGACAGTTGCCTTGCAAGGTGTTCTTAGGGAACAAAG
GAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI29674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64238035..64238209 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036466 (Megf11) NM_172522 multiple EGF-like-domains 11 Gene [Source:MGI (curated);Acc:Megf11-002]


Sequence tag IST14736E7HMF1
Sequence
CCTTGACGTTGAGACAGGTTTTCACATACATAGCTCAGGTTCTCCTTGAACTTGCAGCTTAGTGAAAGATGACCTTGAAC
TCCTGATCCTCCTGCCTCCACCCTTGTTTTGCTGAAATTGGAGGCCTGTGCCACCACACCCGGGTTGTTCAGCGCTGAGA
TTCCAACAAGCTTTGGCAAGCATTCTGCCTTTGCCTCCCCAATCCACTGCCTTCCTTTTAGATGAAGAAGACACACCTTT
CTGAACAATGGTCACCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64237778..64238037 260
NO GENE  

 
Come back to gene ENSMUSG00000036466


For any suggestions or comments, please send an email to unitrap@crg.es