Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14561F9
Clone ID IST14561F9
Vector VICTR74
Project tigm

Sequence tag IST14561F9HMR1
Sequence
GACTAACTAGCATAGCTTTTTAAAGATTTGTATTCTTGAGAGTTTCATACATGTGCAGTGAAATATATTTACTACTAATA
AACCTCCCTCCAACACCCCCATATTCCTCTCAGTACAGTCCCCTAATTTCATGCATGCACACACACACCCCATCTAGTTG
GGGCTACCTTTCTGTGCATGGGTGTTGGACCATCCACTGGAGTGTGGAAATTGTTCCAGTANCCACANCACTCANATTTT
AAATGTAATTTTCCTTACTCTANCANCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003871..97004141 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


Sequence tag IST14561F9BBF1
Sequence
GTCTTTTGTCAATCTGATACTAGAGTTATATAGGAAGAGAGAACCTTTATGGGAAAACGCCTTCAACAGCTTGCCCTCTG
GGCATGTCTGGGCAAGTAGAGGCATTTTCTTGATAATGACTGATGTGGGAGGGTCTAGCCCATGGTGGGTGGTGCCACCC
CTGAGCAGATGGTTTTGGGTTGTTTAGAAAAGCAAAATCAGTAGCCTATGGACAGTAAGCAATGTAAACAGTGTTCCATG
GCCTCTGCTTGAGTTCACACCTTCCTTCAGGTTCTTGCCCTACCTGAATTCCTTCCCTGGCTTTCCGAAGTGATCTACTG
TGATTAGGACAGGTTAAGTCAAACNAACCCTTGCTTGCCCTANCTGCTTTTGGTCATGCATTTATCATACNACAGAAAGC
AANCTANGACAAAAGCCNAATGTGAAAATTANCNNNTATGAAGTATTTGGAGCTGAATGCATTTCCNCTATGCNAAAAAC
ATTTAATATGTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004139..97004631 464
 
EST/CDNA Est Name
  BU516517.1 - BI663713.1 - BB624380.1 - BB661506.1 - CN703639.1 - BB658741.1 - BB858590.1 - CJ065342.1 - BY018951.1 - BY766629.1 - BY013506.1 - BY173463.1 - BY303870.1 - BY009822.1 - BY016748.1 - BY143963.1 - BY032315.1 - BY060654.1 - BY015665.1 - BY015241

 
Come back to gene BU516517.1 - BI663713.1 - BB624380.1 - BB661506.1 - CN703639.1 - BB658741.1 - BB858590.1 - CJ065342.1 - BY018951.1 - BY766629.1 - BY013506.1 - BY173463.1 - BY303870.1 - BY009822.1 - BY016748.1 - BY143963.1 - BY032315.1 - BY060654.1 - BY015665.1 - BY015241


For any suggestions or comments, please send an email to unitrap@crg.es