Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14465C11
Clone ID IST14465C11
Vector VICTR74
Project tigm

Sequence tag IST14465C11HMF1
Sequence
AGATACCATTTCAGAAATGAAAGCAAAGACAGGCAAGAAGGCTTGGTGGACAAAGGGGCTTGCAACCAAACCTGACCACC
TAACTATGATTTCCAGAACCCATGTAGTAGAAGGGAAAAACTAACTCCCGAAAGTTCTCCTCTGACCTCCACACATGGGT
CC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113447252..113447412 161
NO GENE  


Sequence tag IST14465C11HMR1
Sequence
TCTTANNNGTAGCCCTGGTTGGCCGTATCGTGTANTCCGATGCAGCTTGGAACTTTCAGTGATCCTCCTGTATCTATCTC
CTGATTGCTGGGGTTACAGGTTTGTACCACTGCGCC
Sequence Type genomic DNA
Unitrap ID UNI24601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113447419..113447526 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031749 (St3gal2) NM_009179 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI (curated);Acc:St3gal2-001]


Sequence tag IST14465C11BBF1
Sequence
AGATACCATTTCAGAAATGAAAGCAAAGACAGGCAAGAAGGCTTGGTGGACAAAGGGGCTTGCAACCAAACCTGACCACC
TAACTATGATTTCCAGAACCCATGTAGTAGAAGGGAAAAACTAACTCCCGAAAGTTCTCCTCTGACCTCCACACATGGGT
CAACACACACACACACACACACACACACACACACACACACACNNCNNCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113447211..113447412 202
NO GENE  

 
Come back to gene ENSMUSG00000031749


For any suggestions or comments, please send an email to unitrap@crg.es