Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_344B11-3
Clone ID CMHD-GT_344B11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_344B11-3
Sequence
TCCTCCGAGGTGTCGTCCTGTGGCCTCTATCAGGCTCTTGGTGCTAAGTATGGAGAAAAGTGCCTCTACAACTATTGTGC
CTACGATAGGAAGCCTCCCTCTGGGTTCAAGCCATTCACCCCGCCCGCCACTCCTCTGTCACCCT
Sequence Type mRNA
Unitrap ID UNI12510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22411927..22412994 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es