Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10609F5
Clone ID IST10609F5
Vector VICTR76
Project tigm

Sequence tag IST10609F5HMR1
Sequence
CTTCCTTAAGTGCCTAGAGAGCAACCCCTGTCTTCTTTTCTCTGGCTTGTGGTAAAGTTAGTTCTCTCCCCGATTTTGGC
TTTCATCCTAGGCCTGCATGCTTTCTTGCTATCTTCCATCTCTTTTTCACACTGTTCCCACCCACAAATGAATGCCCGGT
CACTCGAGGATGGATTCAGATGTANAGTTTTTCCTGCCTGAGGAGTAAGGGCTGTTANGGGAACAAATGACTGCTTATGA
AGAGACTGGATGANGATAAAAATGGTANTTGGTTCTGGGTTTGGCCTCTGCTGCCTGGCCCATGGTTACNNGGTGTTNNC
GAGGTN
Sequence Type genomic DNA
Unitrap ID UNI29501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35300705..35301029 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024393 (Bat2) NM_020027 HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

 
Come back to gene ENSMUSG00000024393


For any suggestions or comments, please send an email to unitrap@crg.es