Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10493D10
Clone ID IST10493D10
Vector VICTR76
Project tigm

Sequence tag IST10493D10BBF1
Sequence
NAGGAACAGAANAACAAACAAAGAAGTAATAGCGAAAGGTCCCACTGAAGAGTCCATGGCTGCGCTGAGCTGTGCAGGTT
GGGGGAGGAGTGGGAGTGGCCTGTCCTAGGCTCCCAGCATGCANCACGTCTGCNAGCCGGTTGTAGGGAAGTGAAAGAGG
TGGGAGGGTGTATCAGTCAGGGTTCTCTANAGTTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGA
Sequence Type genomic DNA
Unitrap ID UNI19096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4908021..4908250 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022517 (Mgrn1) NP_083933 mahogunin, ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2447670]


Sequence tag IST10493D10HMR1
Sequence
NNCNNNATGAAGATATAGGGAAACNNCNGACTTCTATTTCCAGCCCCTACCCGAGATCCCTAGACATATACTAGTTGCCA
AATGTATACTGAAGGAATGGACAACTATGCTTAAATGTGTTTATTTTTGCCAATTACTGAAGTCCTCTAGGCACTCACAT
TCCCTGTGGGATCGTGGTTTTTCTCCACCGTTCCACAGAATCTGGCTGCTCTCTCTGCTCACACAAAAGGCCTANAATGA
ANTCTCTAACTTGTGCACCCTAGTGGCATCAATTCAATAATGGCTGCTCTGTCCCTCANTGACCCAGTGCTCACTCACTC
TCTGGTTCCTCANAGGCNNTGCCNGGGCACANTCCANNTCNCATGGNNNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4907615..4907974 332
NO GENE  

 
Come back to gene ENSMUSG00000022517


For any suggestions or comments, please send an email to unitrap@crg.es