Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_338E6-3
Clone ID CMHD-GT_338E6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_338E6-3
Sequence
CGACCAGACTGTCAGCACTCCCGGATGCGTGTCCGTCCGTGATCGCATGGTCCCTCCACCACCGCCACCCCACCATCTCT
ACGCGAAGGCGAATACCTCCTCTTCCATCTTCCTGCACTGGAGGAGGCCTGCGTTCACCACCGCCCAAGTCATTAACTAC
ACCATCCGCTGTAACCCTGTTGGCCTGCAGAATGCCTCTCTGGTTCTCTACCTGCAAACATCAGAAACCCACATGCTGGT
CCAAGGACTAGAACCAAAAACC
Sequence Type mRNA
Unitrap ID UNI13027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72738648..72740077 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es