Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_338G9-3
Clone ID CMHD-GT_338G9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_338G9-3
Sequence
TGCAGGGTGCGATTGACCGCCTTATATACGACGAGAACTAAGACTTGTCGGACGTGGAGGAAATTGTCAGCGTCCGTGGC
TTCAGCCTGGAGGAGAAGCTACGTAGCCAGTTATACCAGGGGGACTTCGTGCATGCTATGGAAGGCAAAGATTTTAACTA
TGAGTACGTACAGAGAGAAGCTCTCAGGGTCCCCCTGGTTTTTCGGGACAAGGATGGACTAGGGATCAAGATGCCAGACC
CTGATTTCACAGTCCGAGACGTCAAACTCCTGGTGGGGAGCCGCCGTTTGGTGGATGTCATGGACGTCAACACCCAGAAG
GGTACCGAGATGAGCATGTCCCAGTTTGTGCGCTACTACGAGACACCAGAGGCACAGCGGGATAAACTGTACAACGTCAT
CAGCCTCGAGTTCAGCCATACGAAGCTGGAGCATCTGGTCAAGCGTCCCACTGTGGTGGACCTGGTCGACTGGGTGGACA
ACATGTGGCCTCAGCATCTAAAGGAAAAGCAAACAGAAACCACCAATGCCCTTGCAGAGATGAAGTACCCC
Sequence Type mRNA
Unitrap ID UNI13030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123411033..123437819 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es