Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_338A3-3
Clone ID CMHD-GT_338A3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_338A3-3
Sequence
GTTGCTATTAAAATCATAGATAAGAGCCAGCTGGATGAAAAAAACTTGAAGAAGATTTTCCGGGAGGTTCAGATATTGAA
GATGCTTTGCCATCCACACATCATCAGACTCTACCAGGTAATGGAGACAGAGCGCATGATTTACCTGGTGACAGAATACG
CTAGCGGAGGGGAGATATTTGACCACTTGGGAGCCCATGGAAGAATGGCAGAGAAGGAAGCTCGACGGAAGTTCAAACAG
ATCGTCACAGCGGTGTATTTTTGTCACTGTCGGAATATCGTTCATCGTGATTTAAAAGCCGAAAACTTACTTCTGGACGC
CAATCTGAATATCAAAATAGCAGACTTTGGCTTCAGGCTCCTCTTCACTCCAGGGCAGCTGCTAAAGACGTGGTGTGGAA
GCCCTCCCTATGCCGCCCCAGAGATCTTCGAAGGGAAGGAATATGATGGGCCCAAAGTGGACATATGGAGCCTTGGAGTT
GTCCTCTATGTGCTGGTGTGTGGCGCCCTGCCGTTTGATGGGAGCACACTGCAGAATCTGCGGGCCCGCGTGCTGAGTGG
CAAGTTCCGCATCCCGTTCTTTATGTCCACAGAGTGTGAGCACTTGATCCGCCACATGCTGGTGTTAGATCCAAATAAGC
GCCTCTCGATGGAACAGATCTGCAGGCACAAGTGGATGAAGCTCGGAGATGCAGACCCCAACTTTGACAGGTTAATAGCG
GAGTGGCCAGCAACTGAAGGA
Sequence Type mRNA
Unitrap ID UNI13032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45931300..46002931 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034135 (BC033915) NP_081774 Serine/threonine-protein kinase QSK (EC 2.7.11.1)(Salt-inducible kinase 3)(SIK-3)(SIK3) [Source:UniProtKB/Swiss-Prot;Acc:Q6P4S6]

 
Come back to gene ENSMUSG00000034135


For any suggestions or comments, please send an email to unitrap@crg.es