Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12758C4
Clone ID IST12758C4
Vector VICTR76
Project tigm

Sequence tag IST12758C4BBF1
Sequence
GTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGCATGCATGCANGCATTTN
Sequence Type genomic DNA
Unitrap ID UNI28230 UNI30822 UNI33480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 38934323..38934382 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022299 (Slc25a32) NM_172402 solute carrier family 25, member 32 Gene [Source:MGI Symbol;Acc:MGI:1917156]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155151539..155151598 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038383 (Pigu) NM_001004721 phosphatidylinositol glycan anchor biosynthesis, class U Gene [Source:MGI (curated);Acc:Pigu-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 135547644..135547703 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 118860953..118861012 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038296 (Galntl4) NM_173739 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 Gene [Source:MGI (curated);Acc:Galntl4-002]


Sequence tag IST12758C4HMF1
Sequence
GTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGCATGCATGCATGCATTTTTTTNAANATTTATTTAT
TTATTATATGTAAGTACACTGTAGCTGTCTTCANACACTCCAAAAGAGGGAGTCAGATCTTGTTACAGATGGTTGTGAGC
CACCATGTGGTTGCTGGGATTTGAACTTCANACCTTCNGAAAGCAGTCAGGTGCTCTTACCCACTGANCCATCTCACCAG
CCCGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038296


For any suggestions or comments, please send an email to unitrap@crg.es