Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14837F3
Clone ID IST14837F3
Vector VICTR76
Project tigm

Sequence tag IST14837F3HMR1
Sequence
CNCACNNNAANAGGACATCAGATCTCATTACGGGTGGTTGTGAGCCACCGTGTGGTTGCTGGGATTTGAACTTCGGACCT
TCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTCCCCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261794..14261917 120
NO GENE  


Sequence tag IST14837F3HMF1
Sequence
TGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI30969 UNI30970 UNI30971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18224..18275 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166458: 3877..3928 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317975..318026 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3064037..3064088 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3494084..3494135 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6384761..6384812 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3014548..3014599 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4420126..4420177 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3635713..3635764 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033781 (Asb1) NM_080857 ankyrin repeat and SOCS box-containing 1 Gene [Source:MGI (curated);Acc:Asb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3449335..3449386 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3374447..3374498 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5858060..5858111 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 6197493..6197544 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072742 (AC157601.7-201) Alpha27-takusan [Source:UniProtKB/TrEMBL;Acc:A6NAU4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3277501..3277552 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020539..3020590 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5005563..5005614 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024120..3024171 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3147167..3147218 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211819..3211870 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10730322..10730373 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5755502..5755553 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4105005..4105056 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9681184..9681235 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025912 (Mybl1) NM_008651 myeloblastosis oncogene-like 1 Gene [Source:MGI Symbol;Acc:MGI:99925]

 
Come back to gene ENSMUSG00000025912


For any suggestions or comments, please send an email to unitrap@crg.es