Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11071E2
Clone ID IST11071E2
Vector VICTR76
Project tigm

Sequence tag IST11071E2HMF2
Sequence
NACCNGNCNAANCCGCCCCCCCGGCAGATTCCCCATCCCTGAACCCAANCTCTCCTTTACCGNTTGCATATACACTTGCT
ATTCCCTTAACTGGAGTGCGCTCCTGCCCTGCAGGCTCTTCACCCTGATCCCCCGCTCAGTCTCTATTTAGTATTCTCCT
GATCCTTCTTGAAGACCAAATCCTGGGCTTTTCCCTCTGGGAAGTCTTCTCCCTAGTCATCAGTGAGCCCTTCTTTCCAC
CAAACAGGCTTTTCACTTTCCCTGGGCCCTGTCANAGCANATGGAACAGGTCATAATAGGTCAGGATTTTCTCTCCCAGC
CTTCTTTGTGGGTCTCAGACAGTGGGTTCTGAGGGATGGTCTCCATCCTGCACCCTTCCTANACTGAATCCCGGTGTTAA
CG
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117041258..117041657 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST11071E2BBF1
Sequence
ATCACAAAGCCTGATAGCACAGAATTTATACTGAAAATTCCCCTCACAGCCTGAAGGTGACGGTTGATTAGCTACATGCT
TAGTTTGTATTATTTGAACGAATAAAATAACCATCTGAGTTAGGAGATTTTCCTAGAAATATGGAGAGATGCTCAGAACT
AATATTTTGTTATTTGTAGGATATTATAATTGTTGAGAGCTTTCCCCAAAATGCTTAGATTAATAAGGTGGTTTCCTGTG
GTGTGTGTATTCATTTGAAAAACTCCTCACAGTATGAATTTAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI35741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 190452673..190452959 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026609 (Ush2a) NM_021408 Usher syndrome 2A (autosomal recessive, mild) homolog (human) Gene [Source:MGI (curated);Acc:Ush2a-001]

 
Come back to gene ENSMUSG00000026609


For any suggestions or comments, please send an email to unitrap@crg.es