Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13105D7
Clone ID IST13105D7
Vector VICTR76
Project tigm

Sequence tag IST13105D7HMF2
Sequence
ATATAGCNNTGGGGACAGCTGGAGGACAGTTGATAAAAGGTGTGGGGCTTTTAAATTGGAGTGATTTTTTTTTTTNNCN
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92038168..92038242 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST13105D7BBF1
Sequence
AGCGGGCTCAGTGGGTAAAGGTTCTTGTGAGACTGATGAGTTAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 118677316..118677364 49
NO GENE  

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es