Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606G7
Clone ID IST13606G7
Vector VICTR74
Project tigm

Sequence tag IST13606G7BBF1
Sequence
AGCAGTTTTCTCGAACTGCTCCGAGCGCCCGCGCATCTCGCCAGCCTGGCGCTCCTGCTCCGCCGCCCTANCCGCCAGGT
CCTCGCTGCGGCGACGTTCCTCCGCCNNANTGTCCCGCANTCNANTCATTTCCCGACAGGCTGTGTTNTNNNTNNCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13606G7HMR1
Sequence
TGCTGAGCTCCTGANAGANAAGACAAACCNCCTCATCGGGGCTTGCCGGGACAAGGAAGCCAAGGTGAGCACCGAGGTAT
CCTTGAGAGCATAGCGGGAGCGGAGGTGCTTTTGCAAGGTTGCAGAACCGAAGATCAGATTAATACAAAACAAAGTTCTT
GCAAGGACCGCTTTGTGCTCACCTAGGGCAAGAGGTTTGAGGTTGAGACTGGAGCTGAGGTAGAGTGCAGATAGAAGAAA
GAGATAAAAACAAATAACATAGTACAAGAGAGAAGGCAGCGTAGGTACTACAATTTAATATTCAGGGTTCAGAAGTTATG
TATGCCCCTANGGCTACCACCAGGGNNCNCCGTGGACAATTANTGNTTTATNNTAATCCTGCN
Sequence Type genomic DNA
Unitrap ID UNI31125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96489034..96489415 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST13606G7HMF1
Sequence
AGTTTTCTCGAACTGCTCCGAGCGCCCGCGCATCTCGCCAGCCTGGCGCTCCTGCTCCGCCGCCCTANCCGCCAGGTCCT
CGCTGCGGCGACGTTCCTCCGCNNNNNTGTCCCGCAATCNANTCNTTTCCCGACAGGCTGTGTTGTNCTTCNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es