Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10779D6
Clone ID IST10779D6
Vector VICTR76
Project tigm

Sequence tag IST10779D6HMF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACCAAAACAAACG

Sequence Type genomic DNA
Unitrap ID UNI17308 UNI30696 UNI30697 UNI33485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65277420..65277473 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5555064..5555117 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 112926972..112927025 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19881767..19881820 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045671 (Spred2) NM_033523 sprouty-related, EVH1 domain containing 2 Gene [Source:MGI (curated);Acc:Spred2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44146670..44146723 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62331382..62331435 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59739463..59739516 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11161851..11161904 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72582701..72582754 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072999 (OTTMUSG00000021199) predicted gene, OTTMUSG00000021199 Gene [Source:MGI Symbol;Acc:MGI:3642201]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88957357..88957410 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30609826..30609879 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073102 (Gm1060) NP_001028632 gene model 1060, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685906]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 93082348..93082401 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 45789225..45789278 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 129942155..129942208 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036086 (Zranb3) NM_027678 zinc finger, RAN-binding domain containing 3 Gene [Source:MGI (curated);Acc:Zranb3-001]


Sequence tag IST10779D6BBF1
Sequence
ACACGTTTGCTTTCAGAGAAAAAGCCACTGGGGCCAGATTGAAGCATGGCATGTTTGGTTCATGTAGGGTGGTTGTTGTT
TCTTTTTTTAAAAAAAAACTGGGGGGGAATGATATTGAGTAAACACNATGTAATAGCTGGTCTTTACGTTCTATAAGGGA
ANATAGTGAACAAATGGAACAGGCACACGTTGTACATACAGCAGGTGGTCATGGCTTAAANAACACAGGCAAAAAANATA
CGGACAGAAACCCAGCCAAAGGCCAAGAAGGGAGATAATCGGAACCTATCTGANAGGGANACACTGCGTTTCCATGCCAA
ATGAAATATGCTGTTTTCCAGCCCTATGTCCTGGTGCCCATCTTGTGCACAAACGAGCAAGCCACTAAAAGANGTTGGGT
TTTTTGCTGCTGCTGCTGCTGCTGTTATTGTTTNAANAACAAGANAAACCTCCATGTCAAGCTAATGGTGCTNACTGGAA
GTAGGACAAAATGGAGGGANCTGGGGGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 65739359..65739867 483
NO GENE  

 
Come back to gene ENSMUSG00000036086


For any suggestions or comments, please send an email to unitrap@crg.es