Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12890E5
Clone ID IST12890E5
Vector VICTR76
Project tigm

Sequence tag IST12890E5HMF1
Sequence
NTATTTTACCTTTCTTCATACANANAATANTTATAATCCTANGTGGTTCTAATAGTTATTCAAAACCAATANTACCACTT
ACATACATAAAAGGGAAATTTGTAAAAGCAATTCATGATGGAAATAAAGAAAATGCTTGCNACAATTTGTGAAACTATTG
TTAGTGTTCCACAATCATTTGCTAAAAGGGTTANTAATGATTGTAACACTGAGTCTGGAAAATTTGCCCCTACCTTGGAG
GATATTTTCCTGTCCTANCANCCNAACNCTATGAAAAGTAGATAACTAAATGTTACATTCTTTTAATTTTATGAAAATGA
GTTCCNTATNCTTACTTACTGANGCACTTTTANGTATATCTACNAAGANCTGATCATTTCTGTATCACATGAAATCNGAT
NNNTGTTCACAGTTTGANANATGANAATGTTAAATATCACATCNNNGGTTTTCNTTTNANNTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12890E5BBF1
Sequence
ATATTTTACCTTTCTTCATAGAGAGAATAGTTATAATCCTAGGTGGTTCTAATAGTTATTCAAAACCAATAGTACCACTT
ACATACATAAAAGGGAAATTTGTAAAAGCAATTCATGATGGAAATAAAGAAAATGCTTGCAACAATTTGTGAAACTATTG
TTAGTGTTCCACAATCATTTGCTAAAAGGGTTAGTAATGATTGTAACACTGAGTCTGGAAAATTTGCCCCTACCTTGGAG
GATATTTTCCTGTCCTAGCAGCCAAACACTATGAAAAGTAGATAACTAAATGTTACATTCTTTTAATTTTATGAAAATGA
GTTCCATATACTTACTTACTGAGGCACTTTTAGGTATATCTACAAAGAGCTGATCATTTCTGTATCACATGAAATCTGAT
NATTGNTCACAGTTTGAGAGANGATAATGTTAAATATCACATCTANGTTTTCTTTTAACTTTATGGTTTGCACATTTACA
CNGGTAAATAACTCCCCCAAATATATATNNAACTACCATGTANACCGANTAN
Sequence Type genomic DNA
Unitrap ID UNI33489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 81687569..81688099 513
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es