Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14714C4
Clone ID IST14714C4
Vector VICTR76
Project tigm

Sequence tag IST14714C4HMR1
Sequence
CTGAATTATATGGACTGGCTCTCAGGCAATGAGGACTGCATTCTAAGTAACACAATTAANAATCTGAGGCCCCAAACAAG
GCTATTATTGATAGGTTTGTATTGACGCAAACTTGGCATCTGAAATG
Sequence Type genomic DNA
Unitrap ID UNI17458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91284404..91284530 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]


Sequence tag IST14714C4BBF1
Sequence
CAGCCATTCTNNANNNNNNNAATGTTATTTTTCATCCNGGTTTGGCCCTACATTCAGGCTCAGGCCCTANAACCCCTTCT
TTCTGTCCTCCCGTCCCATCCAGACCCGCTACCGTTCAGGCTCCGCCCCTGTCTCCTACCCACTCCTTCCCCTAACACAT
TACTCCTTTCTTTTCCCGACGCTGAAAAAAGCCCCTACCCAGATACTCGTAGTCCGGTAGAGCTAGGCGCTCGGGACTCA
GCATCCTTTGACCGGGTAGTTTCCACGCTCCAGCTTTCTTCTTCCGGAACCCAGGTTACAGCCTGTCTCTGTTGCCATGG
CACCCAGGCGGCCAGAGGAGAACTAGAAGGCTGAGAGGGTGTCACGTAAACAGTCTCCGACTGGCAACGTANAGCCTATC
ACACAAGTTCCGGAAGCAGTCACTTANAGTCTGATTTTCTTTAACTCCTATTTTTGGGANTTGGTTTTNNNATCTGTGAA
TTNAATTCTCTGAANGTGTCGTANTTTGTGATGCTGAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91284528..91285047 480
 
EST/CDNA Est Name
  BC085239.1


Sequence tag IST14714C4HMF2
Sequence
NNNNACNTNNNANTTTCTCCGCATCACANTAGCAAATCTNCNGCCNGTCTNACTTTCCCANANTTCCCCTCTCTGTCCGG
AAGTCCCACCTTACTATTCTTANTCTGCCTTTTGCTANAGGCCATANGCTTTTTATTTTAACCNNTCNNAAGGTGCCTTA
NGCANGCANGGANNGACANANACACATNTTCNCACATTGTACNANACANCACTCCANCNNNACNNGGTGGTGCATGCCTN
TNATCCGGGCACTCCNGTGACAGANGTNNGTGAATCTCTGTGANTTGCCCGCCACTTGGTCTACATANCGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BC085239.1


For any suggestions or comments, please send an email to unitrap@crg.es