Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_359D6-3
Clone ID CMHD-GT_359D6-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_359D6-3
Sequence
CCCAGCATGCCACCGCTGGAGATATTGGGGTGTCGTGGTACCAGCAGCAGCAAGGAAGTGCTCCCCATCTTCTCTACTAT
TACGCATAATAGGAACACTATCGGGCCGCTGACATCCCCGACAGATTCTCAGCTACCGTGGAGGCCGCCGACGACGCCGG
TATCCTCACCATCAGCCCCGTGCTCCCGGAGGATGATGCCGATTACTTCTGTTCCATCGCCCACACCTTTGAACCCTAGG
GCTGGGTTGAACATCTTCTGTCTCCTAGGTCTGGCCCCTGACCTTGGGCCTCCTCTTTTTCTCTTAAGTCTTGCTTTCTT
TCCTTCCTCTGTGAAATGAGTTAATAACACTGCGACGGGTCAACCACTGTCCTGAGAACTGTGAGATCCTGTGTAAACAA
ATAAATAAAATAAATGTCAAATTGG
Sequence Type mRNA
Unitrap ID UNI13043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75411969..75412392 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000903 (Vpreb3) NM_009514 pre-B lymphocyte gene 3 Gene [Source:MGI (curated);Acc:Vpreb3-002]

 
Come back to gene ENSMUSG00000000903


For any suggestions or comments, please send an email to unitrap@crg.es