Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14757E6
Clone ID IST14757E6
Vector VICTR76
Project tigm

Sequence tag IST14757E6BBF1
Sequence
ATGTATTTCTGCTTTGGGGAGCTTTGTTTTGTTTGTGTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856695..84856752 58
NO GENE  


Sequence tag IST14757E6HMR1
Sequence
CNTTAATATTAAATAATTCTAAATATATATGAACATAAGTTTGTCTATACATTTAAAATACCAATCTTCTACATAAATAA
AATGTTAAATTATTCGAACTATAATGTCTGTCCTCACATTGATGAGGCCTAGTACTTANAAACCTTCCTGTCATTTTGAG
CACTATAGTCTAATGGAAAAGTCTCTGACCTTTTTTGATTTGATTTCTTCCNCTTATGGCTATGCGCCATCANACNNGTC
AGTGGACTTAATTTATTCTANAACTGGGGGCAGAATNNCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856752..84857033 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14757E6HMF1
Sequence
ATGTATTTCTGCTTTGGGGAGCTTTGTTTTGTTTGTGTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856696..84856752 57
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es