Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12825G5
Clone ID IST12825G5
Vector VICTR76
Project tigm

Sequence tag IST12825G5HMR1
Sequence
AGGAAGGAGTTAGAGCTCGCCCGCTGGGTGGTGGGACGTCTTGAGAGGAGGGAACTTGCTCTTGTGCCCTCGAGGCACCA
CCTATGCGGACGCAACGTTC
Sequence Type genomic DNA
Unitrap ID UNI10901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50411693..50411791 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000171 (Sdhd) NM_025848 succinate dehydrogenase complex, subunit D, integral membrane protein Gene [Source:MGI Symbol;Acc:MGI:1914175]


Sequence tag IST12825G5BBF1
Sequence
CCTCTCCCCTGCTTCAGCCTGCAGCAAGAACCTTTGATGGCCAAGACACCTCACCTCGAGCTCCTTGGCCACTGCAGAGA
ACGCCCAGCTTTAANAGAACCGCCATGTCGCTTTCGAGGGCTCAAGGTCACTCTACAACCCGGAAACAGTTATGTAGTAA
GTCCCGCCCCGCGTAAAAGAACGGTGAGGCAACCTGAAGCGTGAACCGGAAGGCAGGAGANNGNGNGCTGCCACCGCGCG
TGCGCACCCCAGCGAAGCGCCTGACTCCGACAATGGCCGANCTTGGTGAAGCGGACGAAGCGGAGTTACAACGCCTGGTG
GCCNCCGAACAGCAGAANGCGCAATTCACTGCGCAGGTACGANGATGANGAANGAACAGGGGAAGGNNGGGTGANGCGCN
NNTCCCGGGCACTCACGGANCTCTGGACACTGCGGCNCAGCNGCCCCNCTCGATCCNGGGCTGCGCCNCCCNNCCCANTG
ATCTACAGTGCTCANTGNNCGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12825G5HMF1
Sequence
TCTCTCCCCTGCTTCAGCCTGCAGCAAGAACCTTTGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50411790..50411828 39
NO GENE  

 
Come back to gene ENSMUSG00000000171


For any suggestions or comments, please send an email to unitrap@crg.es