Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14239H11
Clone ID IST14239H11
Vector VICTR74
Project tigm

Sequence tag IST14239H11HMR1
Sequence
NTTGAACTNAGAAATCTGCCAGCCTCTGCCTCCCAAGTGCTGGGACTAAAGGCTTGCGCCACCATGCCCAGCTGATGGCT
CAGCTCTTAAGAGCACCAACTGCTCTTCCTGAGGTCCTGANTTCAATTCTTAGCAACTACATGGTGGCTCAT
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583544..106583694 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST14239H11HMF1
Sequence
AAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAGA
Sequence Type genomic DNA
Unitrap ID UNI23192

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583693..106583761 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4961893..4961961 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28791230..28791298 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35724983..35725051 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151013985..151014053 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113324393..113324461 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048930 (Tada3l) NM_133932 transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene [Source:MGI (curated);Acc:Tada3l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34746020..34746088 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 133413210..133413278 69
NO GENE  


Sequence tag IST14239H11BBF1
Sequence
AAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAGA
Sequence Type genomic DNA
Unitrap ID UNI23192

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583693..106583761 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4961893..4961961 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28791230..28791298 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35724983..35725051 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151013985..151014053 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113324393..113324461 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048930 (Tada3l) NM_133932 transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene [Source:MGI (curated);Acc:Tada3l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34746020..34746088 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 133413210..133413278 69
NO GENE  

 
Come back to gene ENSMUSG00000048930


For any suggestions or comments, please send an email to unitrap@crg.es