Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14288C8
Clone ID IST14288C8
Vector VICTR74
Project tigm

Sequence tag IST14288C8HMF1
Sequence
AAGGAAGCCCAGAATCTCGAGGCTCTTCTGTGCGACCCACTTCAGTGCCAGCAGCCTACAGGCAGAGGCCAGGCAATGGT
TCGGGGCCACGGGTTGCTCTAGCACGGGACACTATGACAGACCCAGGGGAACGGGCCTGCCATAAATCCAAACCCATGCA
CCAGCACGGAACACCCGAGACCTCCCCCTCTGGTGTCGCCCTANGTCCCGAAGCCACCACGATGGCCCCAGCTCCGCAAA
GTANCCGACAGCGGTGCTCTCCGGTCGTCTTCCNGGGACNCGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121654895..121655177 275
 
EST/CDNA Est Name
  BX639750.1


Sequence tag IST14288C8HMR1
Sequence
CCTTGCCTGTGTAGACACTANCAAAGATTGTCTTTGGTTTTCTGATTCACAAAAATGGAAGAATAANATAANGAACCACA
AAAAAGTTTTTTAGCAAAAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI16951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121655174..121655280 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029614 (Rpl6) NM_011290 ribosomal protein L6 Gene [Source:MGI (curated);Acc:Rpl6-001]


Sequence tag IST14288C8BBF1
Sequence
AAGGAAGCCCAGAATCTCGAGGCTCTTCTGTGCGACCCACTTCAGTGCCAGCAGCCTACAGGCAGAGGCCAGGCAATGGT
TCGGGGCCACGGGTTGCTCTAGCACGGGACACTATGACAGACCCAGGGGAACGGGCCTGCCATAAATCCAAACCCATGCA
CCAGCACGGAACACCCGAGACCTCCCCCTCTGGTGTCGCCCTAGGTCCCGAAGCCACCACGATGGCCCCAGCTCCGCAAA
GTAGCCGACAGCGGTGCTCTCCGGTCGTCTTCCGGGGACGCGGTTCCCCACCTTCAGTCGCGAAGCCCAACGTGGCCNAG
ACAGGCTCAACAGAAGGTTCTGGAACCCCCACTGCAGGGTCGCAAGTCNCAACACAGGCNNTCCNNCCCTCCCCAGGTTA
CGGCANCCGGCAGGGNCNANCGACCATCTCNGGCNCTACGCTNNNTNTTANCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121654722..121655177 422
 
EST/CDNA Est Name
  AI642168.1 - BX639750.1

 
Come back to gene AI642168.1 - BX639750.1


For any suggestions or comments, please send an email to unitrap@crg.es