Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14623C2
Clone ID IST14623C2
Vector VICTR74
Project tigm

Sequence tag IST14623C2BBF1
Sequence
TCAAGGGTCCCTCCGCCCGTTTCTATTTTGTTGCCCTACTGTCTAGGAAAGCATTATCAGATAAATATCTATTGTAAACT
GTACATACAAGTTGCAGGTAGAATTTGAAATTAAAATAATATGATTTGAGCCAGGCGGTGGTGGCGCACGCCTTTAATCC
CAGCTCTTTGGAGGCAGAGGCAGAAACAGGCAGATTTCTGAGTTCGAGGCCAGTCTGGTCTACAAACTGAGTTCCAGGAC
AGCCAGAGCTATACAGAGAAACCCTGTCTCGAAAAACAAAAAACAAACCTTGTCTCAAAAAACCAAAATAAAATAAAATT
TAAAAATAATATGATTTCTTTTTATTTTATGTTCATTGTTGTTTTGCCTGCATGCATGTCAGTGTGAAGATGTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79769180..79769578 399
NO GENE  


Sequence tag IST14623C2HMF2
Sequence
AGGGTTTCTCTGTATAGCCCTGACTGTCCTGGAACTCACTTTGCAGACCAGGCTGGCCTCAAACTCAGAAATCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI19577 UNI30261 UNI31913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 45114408..45114484 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10552837..10552913 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 27131817..27131893 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62664371..62664447 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4550951..4551027 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69313984..69314060 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88468753..88468829 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76093490..76093566 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108261268..108261344 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 40495988..40496064 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109795333..109795409 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93118400..93118476 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681394..32681470 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 70394588..70394664 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564232..7564308 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128630366..128630442 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 70461009..70461085 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053153 (Spag16) NM_029160 sperm associated antigen 16 Gene [Source:MGI Symbol;Acc:MGI:1913972]

 
Come back to gene ENSMUSG00000053153


For any suggestions or comments, please send an email to unitrap@crg.es