Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14961B10
Clone ID IST14961B10
Vector VICTR76
Project tigm

Sequence tag IST14961B10HMR1
Sequence
ATATGTGAAAACATATTGTTTTANAAATCCTTAACAGATGATCTCCATATTTTTAATTTTTTTGTGTATTTGGTGGAGCA
TATGTGTACGTGGTAGGGATGTGTGCACAAAGGCCAGAAGAGGGCACTGAGTGTCTGTTCTATTAAGCTTTCTTCTTTAT
TCCATAGAATGGGTCTCTCACTGANCCTGGAGATCACCAATTAATTGGCTAAACTGAGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI17088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102451283..102451505 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052414 (AC137156.3-201) NM_146065 Cyclic AMP-dependent transcription factor ATF-7 (Activating transcription factor 7)(Transcription factor ATF-A) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0S1]


Sequence tag IST14961B10BBF1
Sequence
ATATGAATACAATTATTATCTAACAAATCTATTAAGGAGAAAGACATATCAGAGAAGCTTAGAAATGGTTGCTTTGGGGC
TGGAGAGATGGCTCAGCAGTTAAGAGTACCGTCTGTGCTTCCAAAGGACCTAAGTTCAGTTCCCAGCACCCACATGGCAG
TTCACAACTGTCTATAATTCCAGTTCCAGGGCATATGACACCCTCACACANACATACTTGGAGGTANAACACCAATGTAN
ATAAAATTAAATTTAANNTATAANANTAAAANANGTGTTGTTTGGCCNGNTGGTGGTGCACGCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102451502..102451804 279
 
EST/CDNA Est Name
  CA563123.1 - BY774560.1 - BY234153.1 - BY178981.1 - BY222463.1 - BY178222.1 - BY217282.1


Sequence tag IST14961B10HMF1
Sequence
GAATACAATTATTATCTAACAAATCTATTAAGGAGAAAGACATATCAGAGAAGCTTAGAAATGGTTGCTTTGGGGCTGGA
GAGATGGCTCAGCAGTTAAGAGTACCGTCTGTGCTTCCAAAGGACCTAAGTTCAGTTCCCAGCACCCACATGGCAGTTCA
CAACTGTCTATAATTCCAGTTCCAGGGCATATGACACCCTCACACAGACATACTTGGAGGTAGAACACCAATGTAAATAA
AATTAAATTTAAAAAATAAAAATAAAAAAAGTGTTGTTTGGCCGGGTGGTGGTGCACGCCTTTAATCNNNNCACTTGGAA
GGCAGANGTAGGCANATTTCTGAGTTNNNNGCCAGCCTGGTCAACNNAGTGAGTTCCNNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102451506..102451882 349
 
EST/CDNA Est Name
  BE287762.1 - BQ560528.1 - BQ569160.1 - CA563123.1 - CA890641.1 - AI592452.1 - CA891708.1 - BY774560.1 - BY234153.1 - BY178981.1 - BY222463.1 - BY178222.1 - BY217282.1 - BY248791.1

 
Come back to gene BE287762.1 - BQ560528.1 - BQ569160.1 - CA563123.1 - CA890641.1 - AI592452.1 - CA891708.1 - BY774560.1 - BY234153.1 - BY178981.1 - BY222463.1 - BY178222.1 - BY217282.1 - BY248791.1


For any suggestions or comments, please send an email to unitrap@crg.es