Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10843B12
Clone ID IST10843B12
Vector VICTR76
Project tigm

Sequence tag IST10843B12HMF1
Sequence
NAGGTAGTACTTTAATGGAGAACATCAAAGGAATGTTCCACCATTCACAGTCACTATTTTTTAAAATTGTATTGGCTGAT
TGATTGATTGATGGGTTATATATATATATGTATTGTACTTGGAATTGAATTCATGTACTANGCACATGTACTANGCACAT
CTCTAACTTGGAGTATTTTATAGTTTATAAAGCCTCANAAAATTANGCCTTGTGGA

Sequence Type genomic DNA
Unitrap ID UNI31266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88348213..88348426 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]


Sequence tag IST10843B12HMR1
Sequence
CCTCCNGGACTNAGGAGGCAGAGGCAGTGGATCTGTGTGAGTTCCAGGCTAGCCTGGTCTACATAGCAAGTTCCAGACCA
GCCAGGACTACACACTGAATTCTAGTTCTACATGTGAGCTCAGGATAACCTGGTCTACAAAACATACTCCAAAGTCCAGC
TCGCCCTGGGCACTTGTGATTAGACATGTTGCCAAGAGTANANCACTGTGCTGAAGTGAGGGGGCGCTCTCANTCCACGC
ACCAATTTAAACAAGGATGGATAGGATTACAGCGCATCCATTCTTCCTGTATTACTCAAAGAGCTCCACAGAATGCCNNG
TANAAAGTGCTTTGTATCTTCCTGGGCNCNNGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88348424..88348770 331
 
EST/CDNA Est Name
  CX730254.1 - BF581623.1 - AI892479.1 - AI325786.1 - AA276991.1 - W85348.1

 
Come back to gene CX730254.1 - BF581623.1 - AI892479.1 - AI325786.1 - AA276991.1 - W85348.1


For any suggestions or comments, please send an email to unitrap@crg.es